Upgrade to enjoy this feature!
Vital MX fantasy is free to play, but Premium users receive great benefits. Premium benefits include:
- View and download rider stats
- Pick trends
- Create a private league
- And more!
Only $10 for all 2026 SX, MX, and SMX series.
https://www.tiktok.com/t/ZP8nRUtRK/
Fuck Fauci. I was working in LA at the height of the pandemic with no mask or shot and never got sick lol
During the lockdown I saved a bunch of money, got in shape, and spent hours on end floating in the pool with my wife and drinking Miller Lite. Pretty much what I was doing anyway! Sucked for the kids but they persevered and kept their grades up.
Was it all BS? No, but doesn’t mean there was no BS. Crisis breeds opportunity, and some took full advantage. Fauci probably falls in that camp.
Sounds like you admire him?
The Shop
Luxon 4-Post Bar Mounts
$189.95 - $239.95
DeCal Works Huge Plastic Inventory of UFO and Polisport kits.
10 Pager !!!
This one is so out there , im steering clear....except for this retort lol
Being angry with Fauci is completely understandable and frankly justified, but it isn't useful. It's wasted energy unless you actually do something constructive with it.
What have we learned from COVID, so we don't make the same mistakes again? What legislation has been enacted to better protect individual and small businesses during such scenarios? What was the point of putting Fauci on the stand? They weren't asking him any scientific or technical questions. They just wanted someone to burn at the stake to distract an increasingly frustrated public. Drama for the reality TV viewers.
Epstein Files were shoved in our faces. Zero accountability. Theatrics with Fauci, good distraction, no accountability. Anyone seeing any patterns here?
Morally break people. Financially break people. Erode motivation. Erode trust. Divide and isolate them. Exhaust them so they don't resist change.
Put your energy into things that are productive. You can't change the past. We can still influence our future. The individual is way more powerful than we give ourselves credit for.
Agree, we did everything asked of us. I had no problem wearing a mask, except when I was mountain biking 😉 it’s interesting, everyone was supposed to work from home and isolate, except the people keeping us safe, fed, clothed, and entertained. They were front facing and had to report to work. Many of which were low income, with no health insurance. Some don’t see it that way, unfortunately.
The anger seems justified, to me.
Fauci and his cadre of government drug marketers pushed changing the G in…
CTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGG
Amd they did so with thier “Safe & Effective” language that they spewed about something they hadn’t had in the lab for more than a coupl’a months.
Genetic “recoding” on the fly…”Safe & Effective”?
As to “changing the G”: messing with your TCGA by changing your GUAC. Playing games with your body’s natural abilities by removing natural components & replacing them with thier lab experiment. Some folks, even in here, are still pitching this as “no big deal”. Huh. I’m not one of them.
First of all the vaccine does nothing to the DNA in your body coding system, if that what you are implying. mRNA is not the same thing and does not effect DNA what so ever. Also the vaccine was a modification of the original SARS vaccine that was started back in 2002. mRNA vaccines are the reason why they can tweek it when they get new variants so quickly.
Different question your reply too. But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned. Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.
He would rather fend for himself than rely on government programs. That is an inherent trait.
Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to pay my bills. Unemployment, even though there was an extra $600 on it, was still $1000 short of my weekly income.
With regard to fishing, recreational and, sport fishing was closed. I rely heavily on fishing to fill my freezer. Several guides I’m friends with were forced to stay home. Meaning, they missed the salmon returns while sitting at home. The fish were gone by the time everything opened up. No fish. No income. No income. No business.
Food stamps and unemployment is your answer. PFFT! GTFO.
Edit: You also missed my point about there being no meat in grocery stores so, stamps are as useless as IOU’s.
If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a good thing until it starts causing a problem for others. I wouldn’t put my ego ahead of my family either. So if taking money or food from the government that I paid into thats what I need to do, I’m ok with that. Also if it helped save someone life, I’m even more into that. That fact that you all seem to careless about how things effects everyone else, well it saying all more about your selfishness. It’s pretty lame.
"old style" liberalism was to question everything the gov't told you. Wars were evil. Gov't was bad. Regulations stifle freedom.
But now, libs do anything gov't tells them, absolutely blindly. When did this happen...and why?
Mother fucker. I was diving at night in 40 degree water harvesting fish and, you want to talk about doing whatever it takes to make sure your family has what it needs?
Do what you’re told.
Big Brother doesn’t appreciate your free thinking!
Holy dipshit Batman.
The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store
At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water. So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it.
Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.
Pit Row
The whole deal is the insanity that they would not let an individual fish, in his case DIVE UNDER FUCKING WATER, outside alone by themselves. Good fucking night. I don't know how you don't admire the shit out of Chance for this. We are fucking doomed.
You are blinded by ignorance. The national guard was brought in to help with the overwhelming amount of unemployment claims. Did you not read where I said, it took six weeks to get an unemployment check. Filing unemployment is one thing. Getting a deposit at that time, TOOK SIX WEEEKS!
You call yourself a free thinker. I think you’re a dip shit.
Thanks. My family was big on spear fishing when I was growing up. Going camping, fishing…. I just fell back on my childhood. Nothing special man. Just an adult game of cops and, robbers lol
Its wild to hear the different things people had to deal with depending on which state you lived in during the pandemic. In NY it was blatant BS everywhere you looked , to watch people not question anything was mind blowing .
How MAGA sees itself
And there it is. The delusion…everything ties back to Trump.
So why haven't you changed your mind yet?
At least subconsciously it's hard for people not to think that way when he had the loudest platform in the world and makes everything about himself. Largely a self-influcted wound. If he did all the exact same things but without the trolling and gumflapping, he wouldn't be the worst president we've had.
The reason is there are no fact to support anything you guys are saying, it’s all just BS conspiracy theories. I go were the facts lead not trying to find what I want to see.
"If he did all the exact same things but without the trolling and gumflapping, he wouldn't be the worst president we've had"....So you like what he does...you just don't like him? That's pretty much the position of 99% of the people that voted for him.
There is only one person less likable that him: Hillary Clinton...Harris is even more likable than him, but she is an absolute bumbling babbling moron.
If people would look past what he says, and just focus on what he's doing...his approval rating would be higher...But to many americans need safe spaces and eco-chambers to function...so they just can't get past his delivery.
For me? I can't wait for the Trump era of American politics to be over...not because I don't like some/most of the things Trump does...but because he is so polarizing and perceived as extreme...and extremism (even perceived extremism) breeds extremism. And America doesn't need extremism...it needs moderation!
Post a reply to: Fauci diary….