Fauci diary….

ohh_454
Posts
3488
Joined
6/24/2023
Location
Nuevo, CA, USA
Fantasy
8/2/2026 7:40am

Fuck Fauci. I was working in LA at the height of the pandemic with no mask or shot and never got sick lol

3
8
LoudLove
Posts
2941
Joined
7/16/2010
Location
USA
8/2/2026 7:48am

During the lockdown I saved a bunch of money, got in shape, and spent hours on end floating in the pool with my wife and drinking Miller Lite. Pretty much what I was doing anyway!  Sucked for the kids but they persevered and kept their grades up. 

Was it all BS?  No, but doesn’t mean there was  no BS. Crisis breeds opportunity, and some took full advantage. Fauci probably falls in that camp. 

3
1
ShellyMX
Posts
870
Joined
3/22/2026
Location
Smyrna, GA, USA
8/2/2026 10:44am
LoudLove wrote:
During the lockdown I saved a bunch of money, got in shape, and spent hours on end floating in the pool with my wife and drinking...

During the lockdown I saved a bunch of money, got in shape, and spent hours on end floating in the pool with my wife and drinking Miller Lite. Pretty much what I was doing anyway!  Sucked for the kids but they persevered and kept their grades up. 

Was it all BS?  No, but doesn’t mean there was  no BS. Crisis breeds opportunity, and some took full advantage. Fauci probably falls in that camp. 

Sounds like you admire him?

1
12

The Shop

Oldschool
Posts
1584
Joined
8/29/2006
Location
USA
8/2/2026 12:42pm

10 Pager !!!

This one is so out there  , im  steering clear....except for this retort lol

1
T-MAC
Posts
692
Joined
8/15/2011
Location
Trabuco Canyon, CA, USA
8/3/2026 12:32am

Being angry with Fauci is completely understandable and frankly justified, but it isn't useful. It's wasted energy unless you actually do something constructive with it.

What have we learned from COVID, so we don't make the same mistakes again? What legislation has been enacted to better protect individual and small businesses during such scenarios? What was the point of putting Fauci on the stand? They weren't asking him any scientific or technical questions. They just wanted someone to burn at the stake to distract an increasingly frustrated public. Drama for the reality TV viewers.

Epstein Files were shoved in our faces. Zero accountability. Theatrics with Fauci, good distraction, no accountability. Anyone seeing any patterns here?

Morally break people. Financially break people. Erode motivation. Erode trust. Divide and isolate them. Exhaust them so they don't resist change.

Put your energy into things that are productive. You can't change the past. We can still influence our future. The individual is way more powerful than we give ourselves credit for.

 

6
1
Dudley
Posts
563
Joined
9/10/2012
Location
Denver, CO, USA
8/3/2026 7:36am
Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

Agree, we did everything asked of us. I had no problem wearing a mask, except when I was mountain biking 😉 it’s interesting, everyone was supposed to work from home and isolate, except the people keeping us safe, fed, clothed, and entertained. They were front facing and had to report to work. Many of which were low income, with no health insurance. Some don’t see it that way, unfortunately. 

1
1
TeamGreen
Posts
37336
Joined
11/25/2008
Location
Thru-out, CA, USA
8/3/2026 7:54am
Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

Dudley wrote:
Agree, we did everything asked of us. I had no problem wearing a mask, except when I was mountain biking 😉 it’s interesting, everyone was supposed...

Agree, we did everything asked of us. I had no problem wearing a mask, except when I was mountain biking 😉 it’s interesting, everyone was supposed to work from home and isolate, except the people keeping us safe, fed, clothed, and entertained. They were front facing and had to report to work. Many of which were low income, with no health insurance. Some don’t see it that way, unfortunately. 

The anger seems justified, to me.

Fauci and his cadre of government drug marketers pushed changing the G in… 

CTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGG 

Amd they did so with thier “Safe & Effective” language that they spewed about something they hadn’t had in the lab for more than a coupl’a months.

Genetic “recoding” on the fly…”Safe & Effective”?

As to “changing the G”: messing with your TCGA by changing your GUAC. Playing games with your body’s natural abilities by removing natural components & replacing them with thier lab experiment. Some folks, even in here, are still pitching this as “no big deal”. Huh. I’m not one of them. 

2
8
matt.3150
Posts
819
Joined
3/20/2015
Location
San Jose, CA, USA
8/3/2026 8:11am
Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

Dudley wrote:
Agree, we did everything asked of us. I had no problem wearing a mask, except when I was mountain biking 😉 it’s interesting, everyone was supposed...

Agree, we did everything asked of us. I had no problem wearing a mask, except when I was mountain biking 😉 it’s interesting, everyone was supposed to work from home and isolate, except the people keeping us safe, fed, clothed, and entertained. They were front facing and had to report to work. Many of which were low income, with no health insurance. Some don’t see it that way, unfortunately. 

TeamGreen wrote:
The anger seems justified, to me.Fauci and his cadre of government drug marketers pushed changing the G in… CTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGG Amd they did so with thier “Safe & Effective”...

The anger seems justified, to me.

Fauci and his cadre of government drug marketers pushed changing the G in… 

CTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGG 

Amd they did so with thier “Safe & Effective” language that they spewed about something they hadn’t had in the lab for more than a coupl’a months.

Genetic “recoding” on the fly…”Safe & Effective”?

As to “changing the G”: messing with your TCGA by changing your GUAC. Playing games with your body’s natural abilities by removing natural components & replacing them with thier lab experiment. Some folks, even in here, are still pitching this as “no big deal”. Huh. I’m not one of them. 

First of all the vaccine does nothing to the DNA in your body coding system, if that what you are implying. mRNA is not the same thing and does not effect DNA what so ever. Also the vaccine was a modification of the original SARS  vaccine that was  started back in 2002. mRNA vaccines are the reason why they can tweek it when they get new variants so quickly.  

4
7
matt.3150
Posts
819
Joined
3/20/2015
Location
San Jose, CA, USA
8/3/2026 8:40am
Robgvx wrote:
I would be interested to know what people think the response should be to a future pandemic with an unquantified mortality rate. Wait and see? Carry...

I would be interested to know what people think the response should be to a future pandemic with an unquantified mortality rate. Wait and see? Carry on as normal as it’ll probably turn out to be nothing? Don’t bother developing a vaccine, or wait five years before rolling out that vaccine while people die in their thousands?

It’s easy to be wise after the event. 

Serious question. If you were in charge, how would you handle it?

matt.3150 wrote:
I think that the people will want to do nothing at first and complain about how there freedoms are being trampled on despite trampling on others...

I think that the people will want to do nothing at first and complain about how there freedoms are being trampled on despite trampling on others right to not get infected. Then when it gets completely out of hand and much harder to control they will complain that nobody did anything soon enough. Or when there dying or looser there family will say no one told me. 

It’s the same shit with global warming, it’s not really happening and don’t want to do anything but once it becomes too late they will whine about it.  

Always blame others. 

Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

6
Zycki11
Posts
7856
Joined
4/1/2008
Location
Edwardsville, IL, USA
8/3/2026 9:18am Edited Date/Time 8/3/2026 9:18am
matt.3150 wrote:
I think that the people will want to do nothing at first and complain about how there freedoms are being trampled on despite trampling on others...

I think that the people will want to do nothing at first and complain about how there freedoms are being trampled on despite trampling on others right to not get infected. Then when it gets completely out of hand and much harder to control they will complain that nobody did anything soon enough. Or when there dying or looser there family will say no one told me. 

It’s the same shit with global warming, it’s not really happening and don’t want to do anything but once it becomes too late they will whine about it.  

Always blame others. 

Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

matt.3150 wrote:
Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family...

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

 He would rather fend for himself than rely on government programs.  That is an inherent trait. 

3
4
Chance1216
Posts
8797
Joined
4/1/2018
Location
Carson, CA, USA
8/3/2026 10:00am Edited Date/Time 8/3/2026 10:06am
matt.3150 wrote:
I think that the people will want to do nothing at first and complain about how there freedoms are being trampled on despite trampling on others...

I think that the people will want to do nothing at first and complain about how there freedoms are being trampled on despite trampling on others right to not get infected. Then when it gets completely out of hand and much harder to control they will complain that nobody did anything soon enough. Or when there dying or looser there family will say no one told me. 

It’s the same shit with global warming, it’s not really happening and don’t want to do anything but once it becomes too late they will whine about it.  

Always blame others. 

Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

matt.3150 wrote:
Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family...

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to pay my bills. Unemployment, even though there was an extra $600 on it, was still $1000 short of my weekly income.  

With regard to fishing, recreational and, sport fishing was closed. I rely heavily on fishing to fill my freezer. Several guides I’m friends with were forced to stay home. Meaning, they missed the salmon returns while sitting at home. The fish were gone by the time everything opened up. No fish. No income. No income. No business. 

Food stamps and unemployment is your answer. PFFT! GTFO. 

Edit: You also missed my point about there being no meat in grocery stores so, stamps are as useless as IOU’s. 

6
1
matt.3150
Posts
819
Joined
3/20/2015
Location
San Jose, CA, USA
8/3/2026 10:10am
Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

matt.3150 wrote:
Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family...

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

Zycki11 wrote:

 He would rather fend for himself than rely on government programs.  That is an inherent trait. 

If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a good thing until it starts causing a problem for others.  I wouldn’t put my ego ahead of my family either. So if taking money or food from the government that I paid into thats what I need to do, I’m ok with that. Also if it helped save someone life, I’m even more into that.  That fact that you all seem to careless about how things effects everyone else, well it saying all more about your selfishness.   It’s pretty lame. 

10
8/3/2026 10:11am

"old style" liberalism was to question everything the gov't told you. Wars were evil. Gov't was bad. Regulations stifle freedom. 

But now, libs do anything gov't tells them, absolutely blindly. When did this happen...and why?

3
7
Chance1216
Posts
8797
Joined
4/1/2018
Location
Carson, CA, USA
8/3/2026 10:12am
matt.3150 wrote:
Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family...

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

Zycki11 wrote:

 He would rather fend for himself than rely on government programs.  That is an inherent trait. 

matt.3150 wrote:
If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a...

If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a good thing until it starts causing a problem for others.  I wouldn’t put my ego ahead of my family either. So if taking money or food from the government that I paid into thats what I need to do, I’m ok with that. Also if it helped save someone life, I’m even more into that.  That fact that you all seem to careless about how things effects everyone else, well it saying all more about your selfishness.   It’s pretty lame. 

Mother fucker. I was diving at night in 40 degree water harvesting fish and, you want to talk about doing whatever it takes to make sure your family has what it needs? 

8
1
TeamGreen
Posts
37336
Joined
11/25/2008
Location
Thru-out, CA, USA
8/3/2026 10:13am
Chance1216 wrote:
What could a private citizen actually do to make governmental changes that, you claim people whine about? During lockdown, what could I have done to open up...

What could a private citizen actually do to make governmental changes that, you claim people whine about? 

During lockdown, what could I have done to open up fishing to feed my family? 

You seem to have all the answers yet, I haven’t seen one solution. 

matt.3150 wrote:
Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family...

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

Chance1216 wrote:
Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to...

Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to pay my bills. Unemployment, even though there was an extra $600 on it, was still $1000 short of my weekly income.  

With regard to fishing, recreational and, sport fishing was closed. I rely heavily on fishing to fill my freezer. Several guides I’m friends with were forced to stay home. Meaning, they missed the salmon returns while sitting at home. The fish were gone by the time everything opened up. No fish. No income. No income. No business. 

Food stamps and unemployment is your answer. PFFT! GTFO. 

Edit: You also missed my point about there being no meat in grocery stores so, stamps are as useless as IOU’s. 

Do what you’re told. 

Big Brother doesn’t appreciate your free thinking! 

2
6
Chance1216
Posts
8797
Joined
4/1/2018
Location
Carson, CA, USA
8/3/2026 10:19am
matt.3150 wrote:
Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family...

Different question your reply too.  But to answer your question, there was easily attain unemployment benefits and food benefits so as far as feeding your family is concerned.   Also if you’re talking commercial fishing that wasn’t banned, certain countries banned recreational fishing.   

Chance1216 wrote:
Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to...

Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to pay my bills. Unemployment, even though there was an extra $600 on it, was still $1000 short of my weekly income.  

With regard to fishing, recreational and, sport fishing was closed. I rely heavily on fishing to fill my freezer. Several guides I’m friends with were forced to stay home. Meaning, they missed the salmon returns while sitting at home. The fish were gone by the time everything opened up. No fish. No income. No income. No business. 

Food stamps and unemployment is your answer. PFFT! GTFO. 

Edit: You also missed my point about there being no meat in grocery stores so, stamps are as useless as IOU’s. 

TeamGreen wrote:

Do what you’re told. 

Big Brother doesn’t appreciate your free thinking! 

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

4
4
matt.3150
Posts
819
Joined
3/20/2015
Location
San Jose, CA, USA
8/3/2026 11:12am
Chance1216 wrote:
Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to...

Dude. You’re delusional. Unemployment took six weeks to receive. Six weeks. For myself, thankfully I had savings to use that shouldn’t have become my lifeline to pay my bills. Unemployment, even though there was an extra $600 on it, was still $1000 short of my weekly income.  

With regard to fishing, recreational and, sport fishing was closed. I rely heavily on fishing to fill my freezer. Several guides I’m friends with were forced to stay home. Meaning, they missed the salmon returns while sitting at home. The fish were gone by the time everything opened up. No fish. No income. No income. No business. 

Food stamps and unemployment is your answer. PFFT! GTFO. 

Edit: You also missed my point about there being no meat in grocery stores so, stamps are as useless as IOU’s. 

TeamGreen wrote:

Do what you’re told. 

Big Brother doesn’t appreciate your free thinking! 

Chance1216 wrote:
Holy dipshit Batman. The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was...

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water.  So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it. 

Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.    

11
mvd61
Posts
1311
Joined
10/15/2021
Location
Brandon, SD, USA
8/3/2026 11:36am
TeamGreen wrote:

Do what you’re told. 

Big Brother doesn’t appreciate your free thinking! 

Chance1216 wrote:
Holy dipshit Batman. The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was...

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

matt.3150 wrote:
At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t...

At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water.  So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it. 

Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.    

The whole deal is the insanity that they would not let an individual fish, in his case DIVE UNDER FUCKING WATER, outside alone by themselves. Good fucking night. I don't know how you don't admire the shit out of Chance for this. We are fucking doomed.

2
Chance1216
Posts
8797
Joined
4/1/2018
Location
Carson, CA, USA
8/3/2026 11:46am
TeamGreen wrote:

Do what you’re told. 

Big Brother doesn’t appreciate your free thinking! 

Chance1216 wrote:
Holy dipshit Batman. The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was...

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

matt.3150 wrote:
At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t...

At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water.  So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it. 

Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.    

You are blinded by ignorance. The national guard was brought in to help with the overwhelming amount of unemployment claims. Did you not read where I said, it took six weeks to get an unemployment check. Filing unemployment is one thing. Getting a deposit at that time, TOOK SIX WEEEKS! 

You call yourself a free thinker. I think you’re a dip shit. 

5
5
Chance1216
Posts
8797
Joined
4/1/2018
Location
Carson, CA, USA
8/3/2026 11:50am Edited Date/Time 8/3/2026 11:51am
Chance1216 wrote:
Holy dipshit Batman. The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was...

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

matt.3150 wrote:
At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t...

At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water.  So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it. 

Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.    

mvd61 wrote:
The whole deal is the insanity that they would not let an individual fish, in his case DIVE UNDER FUCKING WATER, outside alone by themselves. Good...

The whole deal is the insanity that they would not let an individual fish, in his case DIVE UNDER FUCKING WATER, outside alone by themselves. Good fucking night. I don't know how you don't admire the shit out of Chance for this. We are fucking doomed.

Thanks. My family was big on spear fishing when I was growing up. Going camping, fishing…. I just fell back on my childhood. Nothing special man. Just an adult game of cops and, robbers lol

1
1
Carson610
Posts
41
Joined
5/3/2012
Location
Arroyo Grande, CA, USA
8/3/2026 12:01pm
matt.3150 wrote:
If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a...

If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a good thing until it starts causing a problem for others.  I wouldn’t put my ego ahead of my family either. So if taking money or food from the government that I paid into thats what I need to do, I’m ok with that. Also if it helped save someone life, I’m even more into that.  That fact that you all seem to careless about how things effects everyone else, well it saying all more about your selfishness.   It’s pretty lame. 

Lion's life in cage vs wild

6
1
8/3/2026 12:16pm

Its wild to hear the different things people had to deal with depending on which state you lived in during the pandemic. In NY it was blatant BS everywhere you looked , to watch people not question anything was mind blowing . 

2
3
JAFO92
Posts
5733
Joined
3/21/2016
Location
BFE, TX, USA
8/3/2026 12:32pm
TeamGreen wrote:
The anger seems justified, to me.Fauci and his cadre of government drug marketers pushed changing the G in… CTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGG Amd they did so with thier “Safe & Effective”...

The anger seems justified, to me.

Fauci and his cadre of government drug marketers pushed changing the G in… 

CTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGG 

Amd they did so with thier “Safe & Effective” language that they spewed about something they hadn’t had in the lab for more than a coupl’a months.

Genetic “recoding” on the fly…”Safe & Effective”?

As to “changing the G”: messing with your TCGA by changing your GUAC. Playing games with your body’s natural abilities by removing natural components & replacing them with thier lab experiment. Some folks, even in here, are still pitching this as “no big deal”. Huh. I’m not one of them. 

Vaccine 0
4
9
matt.3150
Posts
819
Joined
3/20/2015
Location
San Jose, CA, USA
8/3/2026 12:55pm
matt.3150 wrote:
If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a...

If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a good thing until it starts causing a problem for others.  I wouldn’t put my ego ahead of my family either. So if taking money or food from the government that I paid into thats what I need to do, I’m ok with that. Also if it helped save someone life, I’m even more into that.  That fact that you all seem to careless about how things effects everyone else, well it saying all more about your selfishness.   It’s pretty lame. 

Carson610 wrote:

Lion's life in cage vs wild

How MAGA sees itself


image 3523

4
13
Zycki11
Posts
7856
Joined
4/1/2008
Location
Edwardsville, IL, USA
8/3/2026 1:15pm
matt.3150 wrote:
If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a...

If it’s was my family I would do what it takes to get them what they need to survive. Fending for yourself is fine and a good thing until it starts causing a problem for others.  I wouldn’t put my ego ahead of my family either. So if taking money or food from the government that I paid into thats what I need to do, I’m ok with that. Also if it helped save someone life, I’m even more into that.  That fact that you all seem to careless about how things effects everyone else, well it saying all more about your selfishness.   It’s pretty lame. 

Carson610 wrote:

Lion's life in cage vs wild

matt.3150 wrote:
How MAGA sees itself

How MAGA sees itself


image 3523

And there it is. The delusion…everything ties back to Trump. 

9
7
8/3/2026 1:33pm
TeamGreen wrote:

Do what you’re told. 

Big Brother doesn’t appreciate your free thinking! 

Chance1216 wrote:
Holy dipshit Batman. The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was...

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

matt.3150 wrote:
At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t...

At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water.  So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it. 

Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.    

So why haven't you changed your mind yet?

1
byke
Posts
3096
Joined
8/12/2015
Location
Auburn, CA, USA
8/3/2026 1:44pm
Carson610 wrote:

Lion's life in cage vs wild

matt.3150 wrote:
How MAGA sees itself

How MAGA sees itself


image 3523

Zycki11 wrote:

And there it is. The delusion…everything ties back to Trump. 

At least subconsciously it's hard for people not to think that way when he had the loudest platform in the world and makes everything about himself. Largely a self-influcted wound. If he did all the exact same things but without the trolling and gumflapping, he wouldn't be the worst president we've had.

3
4
matt.3150
Posts
819
Joined
3/20/2015
Location
San Jose, CA, USA
8/3/2026 2:07pm
Chance1216 wrote:
Holy dipshit Batman. The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was...

Holy dipshit Batman. 

The soy boy wants to talk about doing what it takes to feed a family. Fuck. He was probably more pissed that Starbucks was closed then the lack of food in the grocery store

matt.3150 wrote:
At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t...

At that time you could get unemployment within 3 days, even today you can get it in a week. So what one of you said doesn’t hold any water.  So about me what is factual is that I started a manufacturing company at the age of 21. At its height it had 50 employees and I retired at 50. So if that’s soy I’ll take it. 

Free thinkers aren’t people who believe conspiracy theories that have no evidence based on any facts and that continue to believe the nonsense being spewed by there dear leaders, that is called indoctrination. Free thinkers are people who have the able to change there minds when new evidence becomes available regardless of what they personally think.    

So why haven't you changed your mind yet?

The reason is there are no fact to support anything you guys are saying, it’s all just BS conspiracy theories.  I go were the facts lead not trying to find what I want to see.  

4
Titan1
Posts
9443
Joined
2/3/2010
Location
Lehi, UT, USA
8/3/2026 2:08pm
matt.3150 wrote:
How MAGA sees itself

How MAGA sees itself


image 3523

Zycki11 wrote:

And there it is. The delusion…everything ties back to Trump. 

byke wrote:
At least subconsciously it's hard for people not to think that way when he had the loudest platform in the world and makes everything about himself...

At least subconsciously it's hard for people not to think that way when he had the loudest platform in the world and makes everything about himself. Largely a self-influcted wound. If he did all the exact same things but without the trolling and gumflapping, he wouldn't be the worst president we've had.

"If he did all the exact same things but without the trolling and gumflapping, he wouldn't be the worst president we've had"....So you like what he does...you just don't like him?  That's pretty much the position of 99% of the people that voted for him.  

There is only one person less likable that him: Hillary Clinton...Harris is even more likable than him, but she is an absolute bumbling babbling moron.

If people would look past what he says, and just focus on what he's doing...his approval rating would be higher...But to many americans need safe spaces and eco-chambers to function...so they just can't get past his delivery. 

For me? I can't wait for the Trump era of American politics to be over...not because I don't like some/most of the things Trump does...but because he is so polarizing and perceived as extreme...and extremism  (even perceived extremism) breeds extremism. And America doesn't need extremism...it needs moderation!

3
2

Post a reply to: Fauci diary….

The Latest